ppt presentation biotechnology

Biotechnology PPT (Genetic Engineering PPT)

Biotechnology is a rapidly advancing field that utilizes biological systems, organisms, or derivatives to develop products or processes that can benefit society. As a result of its potential to revolutionize various industries, including healthcare, agriculture, and environmental management, biotechnology has gained significant attention in recent years. One of the essential tools for teaching and learning biotechnology concepts is the Biotechnology PPT , or PowerPoint presentation. Here you can find simplified PPT on Biotechnology for your teaching or learning. You can download all the PPT absolutely free without any subscription or payments.

Biotechnology Notes     |     Biotechnology MCQs

Biotechnology PPT

@. Enzyme Immobilization PPT

<<< Back to BIOLOGY PPT Page

No related posts.

Privacy Overview

Home PowerPoint Templates Template Backgrounds BioTech PowerPoint Template

BioTech PowerPoint Template

The BioTech PowerPoint Template provides a slide deck with visuals relevant to biotechnology and its applications. Biotechnology is a field of science that deals with using living organisms to serve humanity. It also involves engineering with genetic material for welfare purposes. In recent eras, medical biotechnologists have developed methods to manufacture drugs, natural products like insulin, and artificial food items through this technology. This PowerPoint template features interactive illustrations to help scientists discuss biotechnology, research data, and similar aspects. The biotechnology PPT template carries 100% editable sections and a text area to enable users to prepare comprehensive presentations. A PowerPoint design fully compatible with all versions of PowerPoint, Google Slides, and Keynote

The first slide of our BioTech PowerPoint Template shows a scientist human illustration wearing a typical lab coat and holding a measuring flask. This slide relates to the idea of research and innovation in the biotech field. Similarly, the following slides have creative visuals of a scientist using the microscope, standing with medicine & flasks, performing lab experiments, etc. Professionals can add their data to each slide according to the requirements. There are some biotechnology slides for innovative aspects of  this kind of technology. For instance, the slides show two scientists joining two big puzzle pieces. Above this PowerPoint shape illustration, there are viruses in the background. Presenters can explain how genetic modification is done to produce vaccines and medication for viral diseases. Likewise, the slide with a robotic hand can indicate the application of machine learning and robotics in biotech advancements.

Our biotech presentation template carries slides with data-driven charts (bar graph, area plot). The flow chart design can be edited to present the flow of events and information in a sequence. An infographic process diagram can help present different methodologies and techniques involved in genetic engineering or biotechnology. So, this Biotechnology PowerPoint template is a complete solution to presenting any topic associated with biotech and scientific innovations in the biological world.

You must be logged in to download this file.

Favorite Add to Collection

Details (15 slides)

Supported Versions:

Subscribe today and get immediate access to download our PowerPoint templates.

Related PowerPoint Templates

Creative Agency Company Profile PowerPoint Template

Corporate Overview Slide Deck Template

Cardiology PowerPoint Template

Human Growth & Development PowerPoint Template

• All Resource

PPT Templates

Single slides.

• Pitch Deck 207 templates
• Animation 326 templates
• Vertical Report 316 templates
• Business 799 templates
• Finance 56 templates
• Construction 45 templates
• IT/Commerce 171 templates
• Medical 64 templates
• Education 45 templates
• Lifestyle 390 templates
• Pitch Decks 138 templates
• Business 539 templates
• Finance 20 templates
• Construction 75 templates
• IT/Commerce 73 templates
• Medical 27 templates
• Lifestyle 578 templates
• Pitch Decks 140 templates
• Business 469 templates
• Finance 19 templates
• Construction 64 templates
• IT/Commerce 72 templates
• Medical 29 templates
• Education 39 templates
• Lifestyle 490 templates
• Cover 266 templates
• Agenda 97 templates
• Overview 216 templates
• CEO 28 templates
• Our Team 142 templates
• Organization 48 templates
• History 38 templates
• Vision, Mission 109 templates
• Problem, Solution 193 templates
• Opportunity 154 templates
• Business Model 158 templates
• Product, Services 299 templates
• Technology 65 templates
• Market 155 templates
• Prices 56 templates
• Customers 55 templates
• Competitor 113 templates
• Business Process 151 templates
• Analysis 222 templates
• Strategy 120 templates
• Marketing, Sales 61 templates
• Profit, Loss 69 templates
• Financials 247 templates
• Timeline 122 templates
• Proposal 40 templates
• Contact Us 272 templates
• Break Slides 16 templates
• List 359 templates
• Process 351 templates
• Cycle 177 templates
• Hierarchy 98 templates
• Relationship 152 templates
• Matrix 86 templates
• Pyramid 67 templates
• Tables 145 templates
• Map 96 templates
• Puzzles 163 templates
• Graph 217 templates
• Infographics 436 templates
• SWOT 111 templates
• Icon 418 templates
• Theme Slides 138 templates
• Mockup 42 templates
• Column 315 templates
• Line 199 templates
• Pie 139 templates
• Bar 179 templates
• Area 130 templates
• X Y,Scatter 16 templates
• Stock 59 templates
• Surface 3 templates
• Doughnut 256 templates
• Bubble 65 templates
• Radar 83 templates
• Free PPT Templates 2,101 templates
• Free Keynote 2,017 templates
• Free Google Slides 2,098 templates
• Free Theme Slides 35 templates
• Free Diagram 126 templates
• Free Chart 49 templates
• New Updates

Result for ' biotechnology '

31 Templates are available.

• Sort by Accuracy
• Sort by Newest

biotechnology Easy PPT Template

Easy to change colors Presentation photos are included; Suitable for creative projects Readily available in both 4:3 and 16:9 aspect ratio Modern layouts based on master slides All elements are editable

biotechnology slide powerpoint

100% fully editable PowerPoint slides Easy to customize without graphic design skills Free font used Suitable for each industries Drag & drop friendly

Navigating the Frontiers of Futuristic Technology pitchdeck powerpoint

Creative slides Professional and unique slides Created with high quality slides High quality, editable pre-designed slides All elements are editable Drag & drop friendly

3D Bioprinting Modern PPT Templates

Data charts (editable via Excel) Smart and innovative presentation slides Shapes: fully editable vector graphics Non-animated Drag & drop friendly

Hospital introduction Themes for PowerPoint

Highly editable presentation template. Possible to change shape and color properties Professional and unique slides Beautiful presentation decks and templates Professional business presentation

Covid-19 Background PowerPoint

Easy customization Presentation photos are included; Completely editable presentation template Professionally designed Created with high quality slides High quality, editable pre-designed slides

Study Chemistry powerpoint template design

Easy customization Quick and easy to customize Easy to change colors Creative slides Free font used Professional look presentation

Wind Powered System - Free PPT Sample

Modern, simple, and clean design Professional business presentation Clean style Creative and innovative presentation slides

Company Pitch Deck PowerPoint

Easy customization 16:9 aspect ratio Modern and clean design Data charts editable via Excel All elements are editable

Science Business Presentation Templates

Easy to edit and customize 100% vector (fully editable maps, infographic, icons) Presentation photos are included; Smart and innovative presentation slides Easy color change 100% fully editable via Excel Drag & drop friendly

Free Images for PowerPoint - Wind Force

Modern, simple, and clean design Professional business presentation Easily editable data driven charts (pie, bar, line) Easy color change

Medical Research PowerPoint Presentations Samples

Built-in custom color palette Data charts (editable via Excel) 100% vector (fully editable maps, infographic, icons) Free images and artwork Smart and innovative presentation slides Modern layouts based on master slides

Multicultural Biologists Interactive PowerPoint Examples

Easy customization Easy editable data driven charts (pie, bar, line) Presentation photos are included; Smart and innovative presentation slides Professional business presentation Easy color change

3D Bioprinter PowerPoint deck Design

Easy to edit and customize Fully editable content (graphics and text) via PowerPoint - No Photoshop needed! Shapes: fully editable vector graphics Drag & drop image placeholders

Post Corona Proposal Presentation Templates

Easy to edit and customize Fully editable content (graphics and text) via PowerPoint - No Photoshop needed! 100% vector (fully editable maps, infographic, icons) Smart and innovative presentation slides

COVID19 Laboratory Testing Templates for PowerPoint

100% fully editable PowerPoint slides Creative slides All images included 100% fully editable via Excel All elements are editable

3D Bioprinter PowerPoint Theme

Modern, simple, and clean design Easy to change colors Completely editable presentation template Professional look presentation Drag & drop friendly

Medical Report - General Hospital Product Deck

Possible to change shape and color properties Premium & modern multipurpose For professionals and educators Created with high quality slides Modern and clean design 100% fully editable via Excel

Stop Animal Testing Theme PPT Templates

Easy editable data driven charts (pie, bar, line) 16:9 aspect ratio Smart and innovative presentation slides For professionals and educators Created with high quality slides Drag & drop friendly

COVID-19 Vaccine Best Business PowerPoint Templates

Easy to change colors Presentation photos are included; Scalable vectorial PowerPoint shapes and PowerPoint icons Premium & modern multipurpose Created by professionals

Free Slides

Slide Members

[email protected]

All Rights Reserved 2024 © Copyright Slide Members

Information

• Privacy Policy
• Terms & Conditions

Recent Slides

• 19+ Recently Powerpoint Templates & Google slides Update
• 9+ New Powerpoint Templates & Google Slides Update
• 18+ New Templates Update (PPT templates & Google slides)

• Ultimate Combo

• Sign Out Sign Out Sign In

61 Best Biotechnology-Themed Templates for PowerPoint & Google Slides

With over 6 million presentation templates available for you to choose from, crystalgraphics is the award-winning provider of the world’s largest collection of templates for powerpoint and google slides. so, take your time and look around. you’ll like what you see whether you want 1 great template or an ongoing subscription, we've got affordable purchasing options and 24/7 download access to fit your needs. thanks to our unbeatable combination of quality, selection and unique customization options, crystalgraphics is the company you can count on for your presentation enhancement needs. just ask any of our thousands of satisfied customers from virtually every leading company around the world. they love our products. we think you will, too" id="category_description">crystalgraphics creates templates designed to make even average presentations look incredible. below you’ll see thumbnail sized previews of the title slides of a few of our 61 best biotechnology templates for powerpoint and google slides. the text you’ll see in in those slides is just example text. the biotechnology-related image or video you’ll see in the background of each title slide is designed to help you set the stage for your biotechnology-related topics and it is included with that template. in addition to the title slides, each of our templates comes with 17 additional slide layouts that you can use to create an unlimited number of presentation slides with your own added text and images. and every template is available in both widescreen and standard formats. with over 6 million presentation templates available for you to choose from, crystalgraphics is the award-winning provider of the world’s largest collection of templates for powerpoint and google slides. so, take your time and look around. you’ll like what you see whether you want 1 great template or an ongoing subscription, we've got affordable purchasing options and 24/7 download access to fit your needs. thanks to our unbeatable combination of quality, selection and unique customization options, crystalgraphics is the company you can count on for your presentation enhancement needs. just ask any of our thousands of satisfied customers from virtually every leading company around the world. they love our products. we think you will, too.

Widescreen (16:9) Presentation Templates. Change size...

PPT theme enhanced with dna helix gene molecule spiral loop 3d genetic chromosome cell dna molecule spiral of blue light on black background for molecular genetic science genome biotechnology and health medicine

Slide deck enhanced with microscope on the workplace near test tubes with different liquid healthcare and biotechnology concept

Slide deck enhanced with laboratory microscope scientific and healthcare research background background

PPT layouts enhanced with laboratory assistant inserting laboratory glass bottle in a chromatograph vial

PPT layouts having woman scientist holding a test tube with plant background

Theme having bioethics crossword in dice letters against green handmade paper ethics medical biological and biotechnology research concept

Presentation theme enhanced with biotechnology

PPT theme featuring chemist in protective suit working with futuristic interface with formula diagram on it

PPT theme having biotechnology concept with scientist in lab

Presentation theme with close-up of scientist holding molecular model against panoramic view of information data on device screen

Presentation consisting of biotechnology

Presentation design featuring biotechnology engineer examining immature corn cob on field backdrop

Slide set enhanced with biotechnology digital background mixed media

Theme enhanced with the hands of a senior medical grade indica marihuana

PPT theme having human takes sample of water

Slides consisting of close up image of human hand holding test tube science concept

Slides having laboratory workplace for biotechnology investigation dna analyze

PPT theme enhanced with plants are cultivated in hydroponic system

Slide deck enhanced with biotechnology scientist working in the lab

Presentation having biotechnology concept with scientist in lab

Slides having young scientist studying new substance or virus in microscope

Slide deck with scientific laboratory growing arabidopsis selection for transgenic plant

Slides with clean laboratory glassware on white background

Slide set featuring doctor or scientist working on biotech experiment in laboratory on microscope

PPT theme having scientific laboratory growing arabidopsis selection for transgenic plant

PPT layouts consisting of scientific microscope in the laboratory

Slides enhanced with microscope on the workplace near test tubes with different liquid healthcare and biotechnology concept

Presentation consisting of scientist in lab conducting biotechnological experiment using pipette and petri dish

PPT theme consisting of criminologist police chemist looking at crime evidence backdrop

Presentation design featuring male sperm donor visiting clinic

Slides having doctor woman working with a microscope

Slides with biotechnology digital background mixed media backdrop

Presentation having businessman with dna concept in his hands

PPT theme consisting of microscope on the workplace near test tubes with different liquid healthcare and biotechnology concept

Slides with group of young scientists studying new substances in flasks background

Slide deck consisting of injection of some substance into fresh red tomatoes

Presentation design featuring lab assistant testing water quality

PPT theme having scientist working in lab doctors making medical research biotechnology chemistry science experiments and healthcare concept day light and window background background

PPT theme with genetic test and biotechnology concept with medical technology devices backdrop

PPT layouts enhanced with biotechnology digital background mixed media

More biotechnology templates for powerpoint and google slides:.

Company Info

• Popular Categories

Powerpoint Templates

Icon Bundle

Kpi Dashboard

Professional

Business Plans

Swot Analysis

Gantt Chart

Business Proposal

Marketing Plan

Project Management

Business Case

Business Model

Cyber Security

Business PPT

Digital Marketing

Digital Transformation

Human Resources

Product Management

Artificial Intelligence

Company Profile

Acknowledgement PPT

PPT Presentation

Reports Brochures

One Page Pitch

Interview PPT

All Categories

Powerpoint Templates and Google slides for Biotech

Save your time and attract your audience with our fully editable ppt templates and slides..

Item 1 to 60 of 277 total items

• You're currently reading page 1

If you require a professional template with great design, then this Biotech Experiment Drug Discovery Medical Professional Working is an ideal fit for you. Deploy it to enthrall your audience and increase your presentation threshold with the right graphics, images, and structure. Portray your ideas and vision using twelve slides included in this complete deck. This template is suitable for expert discussion meetings presenting your views on the topic. With a variety of slides having the same thematic representation, this template can be regarded as a complete package. It employs some of the best design practices, so everything is well-structured. Not only this, it responds to all your needs and requirements by quickly adapting itself to the changes you make. This PPT slideshow is available for immediate download in PNG, JPG, and PDF formats, further enhancing its usability. Grab it by clicking the download button.

This in-depth and intuitively designed Biotech Pitch Deck Ppt Template. It is a resourceful tool for every organization. Use it to showcase your services and present a strategic outlay of your business activities. This complete deck helps give a quick overview of the companys viability. It also targets various topics of interest, thus being a comprehensive tool that you can download and use. Take advantage of this PowerPoint pitch deck to discuss your business plans and vision in an impressive manner. You can also use this deck to give a quick demonstration of your product and its USP that can be shared on Google Slides or PowerPoint. This complete deck comes in an editable format and two aspects ratios, thus increasing its applicability and visibility. It also acts as a visual reinforcer to make your presence felt in the industry.

Deliver a credible and compelling presentation by deploying this Bio Technology Powerpoint Ppt Template Bundles. Intensify your message with the right graphics, images, icons, etc. presented in this complete deck. This PPT template is a great starting point to convey your messages and build a good collaboration. The twlave slides added to this PowerPoint slideshow helps you present a thorough explanation of the topic. You can use it to study and present various kinds of information in the form of stats, figures, data charts, and many more. This Bio Technology Powerpoint Ppt Template Bundles PPT slideshow is available for use in standard and widescreen aspects ratios. So, you can use it as per your convenience. Apart from this, it can be downloaded in PNG, JPG, and PDF formats, all completely editable and modifiable. The most profound feature of this PPT design is that it is fully compatible with Google Slides making it suitable for every industry and business domain.

Provide your investors essential insights into your project and company with this influential Biotechnology Firm Elevator Pitch Deck Ppt Template. This is an in-depth pitch deck PPT template that covers all the extensive information and statistics of your organization. From revenue models to basic statistics, there are unique charts and graphs added to make your presentation more informative and strategically advanced. This gives you a competitive edge and ample amount of space to showcase your brands USP. Apart from this, all the thirty one slides added to this deck, helps provide a breakdown of various facets and key fundamentals. Including the history of your company, marketing strategies, traction, etc. The biggest advantage of this template is that it is pliable to any business domain be it e-commerce, IT revolution, etc, to introduce a new product or bring changes to the existing one. Therefore, download this complete deck now in the form of PNG, JPG, or PDF.

Presenting Biotech Business In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase three stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotech Business. This well-structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

This slide caters details about emerging biotech firm including details about vision statement, success drivers of biotech platform with financial projections of biotech firm. Present the topic in a bit more detail with this Biotech Pitch Deck Overview Of Emerging Biotech Firm. Use it as a tool for discussion and navigation on Overview of Emerging Biotech Firm . This template is free to edit as deemed fit for your organization. Therefore download it now.

This slide caters details about future initiatives by Biotech platform that will focus on leveraging connections across potential stakeholders. Present the topic in a bit more detail with this Biotech Pitch Deck Addressing Future Initiatives By Biotech Platform. Use it as a tool for discussion and navigation on Addressing Future Initiatives by Biotech Platform. This template is free to edit as deemed fit for your organization. Therefore download it now.

Introducing Biotech Pitch Deck Contact Us For Biotech Platform to increase your presentation threshold. Encompassed with three stages, this template is a great option to educate and entice your audience. Dispence information on Contact Us for Biotech Platform, using this template. Grab it now to reap its full benefits.

This slide caters details about success drivers associated to biotech firm in terms of first mover advantage, speed to market, wide range of patents, etc. Present the topic in a bit more detail with this Biotech Pitch Deck Determine Success Drivers Associated To Biotech Firm. Use it as a tool for discussion and navigation on Innovation, Development, Success. This template is free to edit as deemed fit for your organization. Therefore download it now.

Present the topic in a bit more detail with this Biotech Pitch Deck Table Of Contents For Biotech Pitch Deck. Use it as a tool for discussion and navigation on Success, Requirements, Financial. This template is free to edit as deemed fit for your organization. Therefore download it now.

Presenting our set of slides with Biotech Company Employee Monitoring Results. This exhibits information on four stages of the process. This is an easy to edit and innovatively designed PowerPoint template. So download immediately and highlight information on Biotech Company Employee Monitoring Results.

Presenting our set of slides with Biotech Pharmacist Conducting Medical Experiment. This exhibits information on three stages of the process. This is an easy to edit and innovatively designed PowerPoint template. So download immediately and highlight information on Biotech Pharmacist Conducting Medical Experiment.

Introducing our premium set of slides with Pharmacist Analyzing Outcomes For Biotech Firm. Ellicudate the three stages and present information using this PPT slide. This is a completely adaptable PowerPoint template design that can be used to interpret topics like Pharmacist Analyzing Outcomes For Biotech Firm. So download instantly and tailor it with your information.

Introducing our premium set of slides with Medical Expert Conducting Research For Biotech Company. Ellicudate the four stages and present information using this PPT slide. This is a completely adaptable PowerPoint template design that can be used to interpret topics like Medical Expert Conducting Research For Biotech Company. So download instantly and tailor it with your information.

Introducing our premium set of slides with Medical Professional Working For Biotech Company. Ellicudate the three stages and present information using this PPT slide. This is a completely adaptable PowerPoint template design that can be used to interpret topics like Medical Professional Working For Biotech Company. So download instantly and tailor it with your information.

Presenting our Biotech Startup CEO Salary In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases four stages. It is useful to share insightful information on Biotech Startup CEO Salary This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting our Biotech Venture Funds In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases three stages. It is useful to share insightful information on Biotech Venture Funds This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting our Biotech Organizational Structure In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases Four stages. It is useful to share insightful information on Biotech Organizational Structure This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting our Recent Biotech Acquisitions In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases four stages. It is useful to share insightful information on Recent Biotech Acquisitions. This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting our Biotech Product Manager Salary In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases Three stages. It is useful to share insightful information on Biotech Product Manager Salary This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting our Biotech Products In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases four stages. It is useful to share insightful information on Biotech Products This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Engage buyer personas and boost brand awareness by pitching yourself using this prefabricated set. This DNA Research Laboratory Parallel Isolation Operating Biotechnology Structure is a great tool to connect with your audience as it contains high-quality content and graphics. This helps in conveying your thoughts in a well-structured manner. It also helps you attain a competitive advantage because of its unique design and aesthetics. In addition to this, you can use this PPT design to portray information and educate your audience on various topics. With thirteen slides, this is a great design to use for your upcoming presentations. Not only is it cost-effective but also easily pliable depending on your needs and requirements. As such color, font, or any other design component can be altered. It is also available for immediate download in different formats such as PNG, JPG, etc. So, without any further ado, download it now.

This slide showcases global biotechnology market size analysis which provides valuable insights for various stakeholders, and investors. Presenting our well structured Global Biotechnology Industry Detailed Overview. The topics discussed in this slide are Market Size Outlook, Key Purchase Criteria, Adoption Lifecycle. This is an instantly available PowerPoint presentation that can be edited conveniently. Download it right away and captivate your audience.

Presenting List Biotech Stocks In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase three stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like List Biotech Stocks. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Application Transformation Biotechnologyin Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase three stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Application Transformation Biotechnology. This well-structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Biology Biotechnology In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases four stages. It is useful to share insightful information on Biology Biotechnology. This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Biotechnology Data Analyst In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase five stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotechnology Data Analyst. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

This coloured powerpoint icon depicts a nanotechnology virus, a microscopic organism that can be used to create medical treatments and other technological advancements. It is an ideal visual aid for presentations on nanotechnology, medical research, and other related topics.

This monotone powerpoint icon depicts a virus made of nanotechnology. It is perfect for presentations on nanotechnology, viruses, and the future of medicine. It is a high resolution vector graphic that can be easily edited and scaled to fit any presentation.

Presenting Best Biotech Etf In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase five stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Best Biotech Etf. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Biotechnology Engineering Business Work In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases four stages. It is useful to share insightful information on Biotechnology Engineering Business Work This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Biotechnology Etf Demo In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotechnology Etf Demo. This well-structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Small Cap Biotech ETF In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Small Cap Biotech ETF. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Short Biotech Etf In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase Three stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Short Biotech Etf. This well-structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Biotech Licensing Deal Structures In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases four stages. It is useful to share insightful information on Biotech Licensing Deal Structures. This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting our Biotech Valuation Model In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases three stages. It is useful to share insightful information on Biotech Valuation Model. This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Biotechnology Company Organizational Structure In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotechnology Company Organizational Structure. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Life Science Biotechnology Careers In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases two stages. It is useful to share insightful information on Life Science Biotechnology Careers This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Evolution Biotechnology In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Evolution Biotechnology. This well-structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Quality Control Biotech Industry In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases three stages. It is useful to share insightful information on Quality Control Biotech Industry. This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting our Largest Biotech Companies Market Cap In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases three stages. It is useful to share insightful information on Largest Biotech Companies Market Cap. This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting our Biotechnology Index Fund In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases three stages. It is useful to share insightful information on Biotechnology Index Fund. This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

This coloured powerpoint icon on Nanotechnology Water is an ideal visual aid for presentations and lectures. It features a vibrant, eye-catching design that is sure to capture the attention of your audience. It is perfect for use in educational settings and can be used to illustrate the potential of nanotechnology in water treatment.

This Monotone PowerPoint Icon on Nanotechnology Water is a high-resolution vector graphic that is perfect for presentations on nanotechnology and water. It is easy to customize and resize to fit your needs. It is a great way to visually explain the science of nanotechnology and water.

This coloured powerpoint icon features a cyborg with a robotic arm and a glowing eye. It is a perfect choice for presentations related to technology, robotics, artificial intelligence, and more. It is a great way to add a modern and futuristic touch to your presentation.

This Monotone PowerPoint Icon on Cyborg is a great way to add a modern, futuristic feel to your presentation. It features a black and white image of a cyborg, perfect for adding a unique and eye catching design to your slides. Its a great way to make your presentation stand out.

Presenting Biotech Index Funds Business In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotech Index Funds Business. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

This coloured powerpoint icon depicts nanotechnology virus and is perfect for presentations on the topic. It is a high-resolution vector image with vibrant colours and sharp lines. It is easy to use and can be scaled to any size without losing quality. It is a great way to illustrate the concept of nanotechnology virus.

This Monotone Powerpoint Icon is a great visual representation of Nanotechnology Virus. It features a dark grey virus-like shape with a white background. Perfect for presentations on nanotechnology, viruses, and other related topics.

Presenting our Top Biotech Cities In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases three stages. It is useful to share insightful information on Top Biotech Cities. This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Biotech Investment Banking In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotech Investment Banking. This well-structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Best Biotech Companies Invest In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases three stages. It is useful to share insightful information on Best Biotech Companies Invest This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Best Biotech Funds In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Best Biotech Funds. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Best Biotech Mutual Fund In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases four stages. It is useful to share insightful information on Best Biotech Mutual Fund This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Best Biotech Stocks In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Best Biotech Stocks. This well-structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Biotech ETFS Good Investment In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase five stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotech ETFS Good Investment. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Three Biotech Funds In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase three stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Three Biotech Funds. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Biotech Companies Invest In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase three stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotech Companies Invest. This well-structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Biotech Stocks Under In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotech Stocks Under. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Biotechnology Stocks Invest In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases four stages. It is useful to share insightful information on Biotechnology Stocks Invest This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting our Biotechnology Stock Market In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases three stages. It is useful to share insightful information on Biotechnology Stock Market This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Bharat Biotech Stock Price In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Bharat Biotech Stock Price. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Best Biotech Stocks Under In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Best Biotech Stocks Under. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Biotech Mutual Fund In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase three stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotech Mutual Fund. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Biotechnology Best Biotech Stocks In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase six stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotechnology Best Biotech Stocks. This well-structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Medical Device Stocks Biotech In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases four stages. It is useful to share insightful information on Medical Device Stocks Biotech This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting our Top Biotech Companies Work In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases three stages. It is useful to share insightful information on Top Biotech Companies Work. This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting our Biotech Mutual Funds In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases three stages. It is useful to share insightful information on Biotech Mutual Funds. This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Biotech Index Funds In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotech Index Funds. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Viruses Tools Biotechnology In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Viruses Tools Biotechnology. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Biotech Stock Price List In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotech Stock Price List. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting Biotechnology Investment Funds In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotechnology Investment Funds. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Biotech ETF Stock In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases four stages. It is useful to share insightful information on Biotech ETF Stock This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Biotechnology ETF Stocks In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase three stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotechnology ETF Stocks. This well-structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Biotechnology Agriculture Job In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases five stages. It is useful to share insightful information on Biotechnology Agriculture Job This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Biotechnology Index ETF In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase three stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biotechnology Index ETF. This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Presenting our Biotech Index Performance In Powerpoint And Google Slides Cpb PowerPoint template design. This PowerPoint slide showcases five stages. It is useful to share insightful information on Biotech Index Performance This PPT slide can be easily accessed in standard screen and widescreen aspect ratios. It is also available in various formats like PDF, PNG, and JPG. Not only this, the PowerPoint slideshow is completely editable and you can effortlessly modify the font size, font type, and shapes according to your wish. Our PPT layout is compatible with Google Slides as well, so download and edit it as per your knowledge.

Presenting Biggest Biotech Companies In Powerpoint And Google Slides Cpb slide which is completely adaptable. The graphics in this PowerPoint slide showcase four stages that will help you succinctly convey the information. In addition, you can alternate the color, font size, font type, and shapes of this PPT layout according to your content. This PPT presentation can be accessed with Google Slides and is available in both standard screen and widescreen aspect ratios. It is also a useful set to elucidate topics like Biggest Biotech Companies This well structured design can be downloaded in different formats like PDF, JPG, and PNG. So, without any delay, click on the download button now.

Slidesgo.net is an independent website that offers free powerpoint templates and is not part of Freepik/any particular brand. Read the privacy policies

biotechnology Powerpoint templates and Google Slides themes

Discover the best biotechnology PowerPoint templates and Google Slides themes that you can use in your presentations.

Microtiter-Education PowerPoint Templates

Medical development powerpoint template, genome editing medical powerpoint templates, vaccine development powerpoint templates, slidesgo categories.

• Abstract 13 templates
• Agency 15 templates
• All Diagrams 1331 templates
• Brand Guidelines 3 templates
• Business 195 templates
• Computer 66 templates
• Education 97 templates
• Finance 54 templates
• Food 57 templates
• Formal 60 templates
• Fun 6 templates
• Industry 91 templates
• Lesson 67 templates
• Marketing 57 templates
• Marketing Plan 19 templates
• Medical 71 templates
• Military 21 templates
• Nature 119 templates
• Newsletter 5 templates
• Real Estate 46 templates
• Recreation 53 templates
• Religion 30 templates
• School 557 templates
• Simple 5 templates
• Social Media 8 templates
• Sports 46 templates
• Travel 26 templates
• Workshop 4 templates

Slidesgo templates have all the elements you need to effectively communicate your message and impress your audience.

Suitable for PowerPoint and Google Slides

Download your presentation as a PowerPoint template or use it online as a Google Slides theme. 100% free, no registration or download limits.

Want to know more?

• Frequently Asked Questions
• Google Slides Help
• PowerPoint help
• Who makes Slidesgo?

• Preferences

Introduction to Biotechnology - PowerPoint PPT Presentation

Introduction to Biotechnology

According to the academic standards for science and technology, biotechnology is the ways that humans apply biological concepts to produce products and provide ... – powerpoint ppt presentation.

• Graduates work in
• pharmaceutical companies and hospitals (e.g diagnostics)
• medical Lab (e.g insulin, cloning)
• agricultural industries and dept of Agriculture (crops and animals eg the broccoflower, Dolly the sheep, cloning)
• in beverage and food production ( wine and dairy products)
• in a range of public and private diagnostic, research laboratories covering
• microbiology, hematology, bioremediation,
• immunology, forensic science (suspect in crime scenes)
• crop development, pest control (Biological control)
• animal production, veterinary services,
• molecular biology and protein engineering (e.g insulin, yeast for fermentation)
• The career options are expanding rapidly.
• Advances in
• genetic engineering,
• protein engineering,
• cell culture and
• molecular biology have generated a virtually unlimited potential for altering the capabilities of living systems.
• Biotechnology is essentially
• the use of living organisms (often minute microorganisms) and their products
• for health, social or economic purposes.
• Biotechnology is widely considered to be the growth technology of the 21st Century and this will lead to huge growth in the Biotechnology industry and exciting opportunities for graduates.
• Applications of biotechnology are widespread, including the following
• diagnosis and treatment of human diseases.
• improved production of therapeutic agents.
• development of improved crop plant species.
• development of improved pest/pathogen control processes.
• development of biosensors for environmental pollutants.
• development of improved waste treatment processes and methods for remediation contaminated sites.
• production of transgenic organisms for production of new drugs, improved transplantation success and improved animal and plant
• According to the Academic Standards for Science and Technology, Biotechnology is the ways that humans apply biological concepts to produce products and provide services. 
• Long before the term "biotechnology" was coined for the process of using living organisms to produce improved commodities, people were utilizing living micro-organisms to produce valuable products.
• History of Biotechnology (Refer pg 2 text bk.).
• Our ancestors used microorganisms and used fermentation to make bread, cheeses, yogurt, alcoholic beverages etc.
• One of the most widespread and commonly understood applications of Biotechnology is the use of antibiotic Penicillin from the mold Penicillium (A.Flemming, 1928).
• In 1940, penicillin became widely a available, scale-up and commercial production of antibiotics such as penicillin occurred.
• About two decades ago, biotechnology became much more of a science (rather than an art).
• Since 1960, rapid development of our understanding of genetics and molecular biology has led to exciting new innovations and applications in Biotechnology.
• The secrets of DNA structure and functions have led to gene cloning and genetic engineering, manipulating the DNA of an organism.
• Regions of DNA (called genes) were found to contain information that would lead to synthesis of specific proteins
• A natural gene in simple bacteria such as Escherichia coli (E. coli), a bacterium living in intestines that has become the model organism for much of biotechnology, if found in this bacterium, scientist can have this bacterium make a lot of the protein coded for by the gene, regardless its source.
• Through genetic engineering scientists can combine DNA from different sources and this process is called recombinant DNA technology (Chapter 3).
• Recombinant DNA technology has led to hundreds of applications including development of disease resistant crops with greater yield and nutrient value or genetically engineered bacteria able to degrade environmental pollutant (Discussed under bioremediation).
• Hence the mid-eighties and early-nineties, it became possible to transform (genetically modify) plants and animals that are important for food production. "Transgenic" animals and plants, including cows, sheep, tomatoes, tobacco, potato, and cotton have now been obtained.
• Recombinant DNA technology and genetic engineering led to release of genetically altered organisms into the environment, this part of biotechnology is quite strictly regulated at government levels (Biotechnology regulation will be discussed).
• Completed in 2003, the Human Genome Project (HGP) was a 13-year project coordinated by the U.S. Department of Energy and the National Institutes of Health. During the early years of the HGP, the Wellcome Trust (U.K.) became a major partner additional contributions came from Japan, France, Germany, China, and others.
• identify all the approximately 20,000-25,000 genes in human DNA,
• determine the sequences of the 3 billion chemical base pairs that make up human DNA,
• store this information in databases,
• improve tools for data analysis,
• transfer related technologies to the private sector, and
• address the ethical, legal, and social issues (ELSI) that may arise from the project
• Biotechnology can be broadly defined as the application of biological systems or processes to the manufacturing, agricultural, health and service industries.
• Biotechnology encompasses a wide range of science and business disciplines
• The following lists the main areas and application of Biotechnology from which all others stem
• Fermentation Technology
• This is, historically, the most important area in biotechnology. There has been extensive development in progress with new products such as medically important drugs, solvents, protein enhanced foods, etc.
• Enzyme Engineering
• This area is used for the catalysis of extremely specific chemical reactions to create specific molecular converters (bioreactors). Products formed include amino acids, high fructose syrup, semi-synthetic penicillins, starch and cellulose hydrolysis, etc.
• Waste Technology
• This has a long array of historical importance, but now emphasis is on the coupling of this field with the conservation and recycling of resources. Examples would include foods, fertilizers, and biological fuels.
• Environmental Technology
• Problems like pollution control, removing toxic wastes, recovery of metals from mining wastes and low grade ores, are just some of the categories that fall under this field.
• Renewable Resources Technology
• The use of renewable energy sources, in particular lignocellulose to generate new sources of raw material and energy - ethanol, methane, and hydrogen.
• Each of these fields utilizes knowledge from Biochemistry, Genetics, Chemistry, Applied Microbiology, Chemical and Process Engineering, and Mathematics and Computer Technology.
• The first product of modern biotechnology made use of insulin, a protein hormone produced in the pancreas that the body uses to regulate the concentration of blood sugar (glucose).
• Agricultural,
• Bioremediation,
• Aquatic and
• Medical Biotechnology.
• Selective breeding
• Selective breeding for new genetic combinations
• livestock, crops,
• yogurt, cheese bread, beer.
• Genetic Engineering
• Genetic engineering makes it possible for organisms to get genes from different species makes products useful in agriculture
• Genetically Modified Foods
• Genetically modified foods - produce plants that yield more food, produce new types of food, plants prone to diseases and severe weather increase the disease resistance, size and growth rate of animals, in medicine and industry.
• Environmental Biotechnology
• Environment (bioremediation, heavy metal biotechnology, species preservation).
• Gene Therapy
• Gene therapy replace defective genes with healthy ones (use of viruses).
• Further Readings
• Types of Biotechnology
• Jobs in Biotechnology
• Browse Web Links
• Introduction to Biotechnology by W.J. Thieman and M.A. Palladino. Pearson Benjamin Cummings 2nd edition.
• http//en.wikipedia.org

PowerShow.com is a leading presentation sharing website. It has millions of presentations already uploaded and available with 1,000s more being uploaded by its users every day. Whatever your area of interest, here you’ll be able to find and view presentations you’ll love and possibly download. And, best of all, it is completely free and easy to use.

You might even have a presentation you’d like to share with others. If so, just upload it to PowerShow.com. We’ll convert it to an HTML5 slideshow that includes all the media types you’ve already added: audio, video, music, pictures, animations and transition effects. Then you can share it with your target audience as well as PowerShow.com’s millions of monthly visitors. And, again, it’s all free.

About the Developers

PowerShow.com is brought to you by  CrystalGraphics , the award-winning developer and market-leading publisher of rich-media enhancement products for presentations. Our product offerings include millions of PowerPoint templates, diagrams, animated 3D characters and more.

Got any suggestions?

We want to hear from you! Send us a message and help improve Slidesgo

Top searches

Trending searches

8 templates

55 templates

ai technology

148 templates

citizenship

14 templates

13 templates

9 templates

All About Plant Biotechnology

All about plant biotechnology presentation, premium google slides theme and powerpoint template.

Dive into the domain of plant biotechnology with our innovative Google Slides and PowerPoint presentation template. Designed to transform complicated theories into understandable visuals, this template is brimming with simple yet striking illustrations of plants. Whether you're breaking down the process of genetic modification or elaborating on tissue culture techniques, our template simplifies the learning process. Perfect for teachers, students, or anyone with a curiosity about plant sciences. Take your audience on a captivating journey through the wonders of plant biotechnology.

Features of this template

• 100% editable and easy to modify
• 35 different slides to impress your audience
• Contains easy-to-edit graphics such as graphs, maps, tables, timelines and mockups
• Includes 500+ icons and Flaticon’s extension for customizing your slides
• Designed to be used in Google Slides and Microsoft PowerPoint
• 16:9 widescreen format suitable for all types of screens
• Includes information about fonts, colors, and credits of the resources used

What are the benefits of having a Premium account?

What Premium plans do you have?

What can I do to have unlimited downloads?

Don’t want to attribute Slidesgo?

Gain access to over 22200 templates & presentations with premium from 1.67€/month.

Are you already Premium? Log in

Related posts on our blog

How to Add, Duplicate, Move, Delete or Hide Slides in Google Slides

How to Change Layouts in PowerPoint

How to Change the Slide Size in Google Slides

Related presentations.

Premium template

Unlock this template and gain unlimited access

Free Biotechnology PowerPoint Template

A free technology background template for powerpoint with human and robot finger connection.

Free Biotechnology PowerPoint Template is a presentation slide template for PowerPoint that you can use to prepare presentations for a variety of biotechnology presentation purposes and topics. The biotechnology PPT template contains a modern title slide featuring a robot and human hand connection graphic over a DNA dna strand.

This bio technology PPT template can be used to prepare presentations on biotechnology topics and artificial Intelligence presentation topics, featuring AI algorithms for biotechnology and science. You can use this presentationt emplate to present a biomolecular process or to present the development of technology around biotechnology concepts that improve to save our lives and the health of the planet.

Here are some possible use cases of biotechnology presentation template in real-life presentations.

• Academic Lectures and Seminars : This biotechnology slide template could be used by professors, lecturers, or researchers presenting on topics such as genetic engineering, cellular biology, or the role of artificial intelligence in biotechnology. Using the template they can create a biotechnology lesson for lectures or science fair presentation projects .
• Biotech Startup Pitches : Entrepreneurs or startups in the biotech industry could use this biotechnology PPT template to present their business model, product, or innovation to investors or venture capitalists.
• Conferences and Symposia : Scientists presenting research findings at conferences or symposia might use this biotechnology presentation template for PowerPoint & Google Slides to provide a clear, visual representation of their work, such as novel techniques in gene editing or new applications of AI in biotechnology.
• Corporate Presentations : Companies involved in biotechnology or bioinformatics could use this biotechnology PPT template for internal presentations, discussing project updates, sharing R&D progress, or introducing new biotechnological tools or processes.
• Medical and Healthcare Meetings : The biotech slide template could be used in medical and healthcare contexts to discuss advances in medical biotechnology, such as the development of new drugs ( drug discovery ), diagnostics, or therapies.
• Educational Workshops : Educators or trainers could use the biotecnology PowerPoint template to present complex biotechnological concepts in a simplified, easy-to-understand manner during workshops or training sessions.
• Policy and Legislation Discussions : Advocates, policymakers, or lawmakers could use this template when discussing the regulatory landscape of biotechnology and its related fields, highlighting the need for specific legislation or policy changes.
• Environment and Sustainability Presentations : Environmental scientists or advocates might use the biotechnology presentation template to present on the application of biotechnology in environmental conservation, such as the development of biofuels or the use of genetically modified organisms (GMOs) to promote biodiversity.
• Agriculture and Food Technology Forums : This template could be useful in presenting advances in agricultural biotechnology, such as the development of drought-resistant crops, pest-resistant GMOs, or the role of biotechnology in food production and security.
• Bioethical Debates : The template could be employed in debates or discussions centered around the ethical implications of certain biotechnological applications, like gene editing, cloning, or the use of AI in biological research.

Alternatively, you can download other biotech PPT templates and technology-related backgrounds for PowerPoint.

Slides Preview

Register for free to download

Download In Progress…

Download will begin shortly. If you liked our content, please support our site helping us to spread the word. This way we can continue creating much more FREE templates for you.

For serious presenters, we recommend...

Slidemodel.com.

Fast-growing catalog of PowerPoint Templates, Shapes & Diagrams for Presentations.

Presenter Media

Animated PowerPoint Templates, 3D templates and Cliparts for PowerPoint

FREE registration required to download

• Download featured templates, for FREE!
• Transfers at maximum speed.
• We respect your privacy

We will send you our curated collections to your email weekly. No spam, promise!

• _PDF Printed Notes
• _PPT Slides
• _PPT Slides in PDF format
• _Intext Questions & Answers
• _Exercise and Answers
• _MCQs and Answers
• _Online Test Series
• _Activity Solutions
• _PDF Printed notes
• _Capsule Notes
• _Class 10 PPT
• _Class 11 PPT
• _Class 12 PPT
• _Exam Capsule PPT
• Online Tests
• _Chemistry Notes
• _Animal Facts
• _Body Facts
• _Comparison between
• _What and Why

Biotechnology and its applications | PPT PDF slides | Class 12/Plus 2/CBSE

Biotechnology and its applications , 👉  part 1: application in agriculture, 👉  part 2: application in medicine, 👉  part 3: transgenic animals, ethical issues.

These ppts were life saving during these covid times...

❤️💕🔥

Very great job sir... it's very helpful... Thank you so much sir 🙏

PLEASE UPLOAD IN PDF

Yes pls upload in pdf form

Biotechnology

Apr 07, 2019

1.28k likes | 2.49k Views

Biotechnology. bios = life technos = tool logos = study of Biotechnology = The Study of Living Tools. 1. Timeline. 4000 BC Egyptians use yeasts for bread and wine 1750 BC Sumerians brew beer 1500 AD Aztecs make cakes from Spirulina algae 1917 Biotechnology term coined

Share Presentation

• popular shasta daisies
• celera genomics
• inducing mutations
• first test tube baby
• international maize

Presentation Transcript

Biotechnology bios = life technos = tool logos = study of Biotechnology = The Study of Living Tools

1. Timeline • 4000 BC Egyptians use yeasts for bread and wine • 1750 BC Sumerians brew beer • 1500 AD Aztecs make cakes from Spirulina algae • 1917 Biotechnology term coined • 1972 Hamilton Smith discovers first restriction enzyme • 1973 Stanley Cohen made first transgenic organism with gene from African clawed toad into bacteria • 1978 Louise Brown, first test tube baby born • 1981 PCR Invented by Kary Mullis Genentech releases (Humulin) human insulin • 1984 PCR used by Alec Jeffries in DNA fingerprinting EPA approves release of genetically engineered tobacco • 1990 Pfizer introduces Chymosin (Rennin) • Michael Crichton’s Jurassic Park published • 1993 FDA approval of Monsanto’s rBGH/rBST • 1994 Calgene introduces Flavr-Savr Tomato • 1995 O.J. Simpson Trial • 1996 Sequence completed for S. cervisiae • 1997 Cloning of Dolly at Roslin Institute • 1998 First animal genome sequenced: C. elegans James Thompson (UW-Madison) develops procedure for culturing stem cells 40 million hectares of GM crops planted globally (soy, cotton, canola, corn) • 1999 ‘Golden Rice’ developed • 2000 First Plant Genome Sequenced – Arabidopsis thaliana • 2001 Drosophila genome published First cloned cat – “carbon copy” • 2003 Completion of Human Genome Project • 2005 Rice Genome Sequenced • 2007 GM meat approved for use

Selective Breeding a. Luther Burbank • disease resistant Burbank potato • fight blight, etc in Ireland b. Norman Borlaug of International Maize & Wheat Research Center in Mexico (received Nobel Prize) • Crossed short-stemmed wheat with Mexico’s best wheat • Gov’t of India requested seeds, as tall wheat plants falling over • Increased wheat production from 12 million metric tons in 1965, to 20 million in 1970, 37 million in 1982 c. Hybridization • Dissimilar individuals mate to hope to get desired traits • Burbank: Popular Shasta Daisies d. Inbreeding • Keep desired traits • Brings recessive traits too (joints in golden retrievers)

Increasing Variation a. Inducing mutations in bacteria • Radiation, chemicals, r-strategists • Can clean up oil spills (bioremediation) b. Polyploidy (extra chromosomes) • Usually fatal in animals • Bigger, stronger, sexier plants (bananas, citrus fruits, day lilies)

DNA Manipulation 1. Cutting & Separating a. Restriction Enzymes • Proteins from bacteria that cut DNA at specific points • Cut at palindromes • Evolved as viral defenses • Can have blunt or sticky ends • Can be spliced into DNA cut with same RE Naming of EcoR1: E from genus of organism where found (Escheria) co first 2 letters of species name (coli) R Strain (RY13) 1 Order discovered

Restriction Enzymes

(Cutting & Separating, Cont’d) b. Gel Electrophoresis • Migration of charged particles under electric field • DNA has negatively charged phosphate ends • (-) electrode repels DNA, (+) electrode attracts DNA • 1% agarose gel (natural colloid from seaweed) • agarose is convoluted – like a sieve • TBE solution is electrolytic solution • Migration of DNA molecules move through gel at different rates (bigger = slower, smaller = faster) • DNA is stained to see bands (Ethidium Bromide) • Usually a marker is used (of known fragment sizes)

Digest & Separation

(Cutting & Separating, Cont’d) c. Restriction Mapping • Use of various restriction enzymes • Gel digests show size of fragments • Patterns of digests can create restriction map • pUK 1 plasmid: Gel Digest Restriction Map

Restriction digest of plasmid DNA from Escherichia coli • run on a 1% agarose gel and stained with ethidium bromide • Lane 1 (far left) is a kilobase DNA ladder • Lane 2 is the uncut plasmid DNA • Lane 3 is a single digestion of the plasmid with the EcoRI • Lane 4 is also a single digestion, but with XhoI • Lane 5 (far right) is a double digestion - both EcoRI and XhoI

DNA Manipulation, Cont’d 2. Identifying Genes - Southern Blot (named after Ed Southern) a. DNA cut with RE’s b. Separated by Gel Electrophoresis c. DNA “blotted” to filter paper and probe is added d. Only DNA fragments with identified gene bind to probe

Southern Blot

DNA Manipulation, Cont’d 3. Nucleotide Sequencing (fluorescent dye-terminator cycle sequencing) a. Unknown Single Stranded DNA put in test tube b. DNA polymerase and nucleotide bases (dNTP’s) added c. Small number of bases with flourescent dye attached (ddNTP’s) d. Each time dye-labeled nucleotide binds to fragment, synthesis stops e. Ultimately yields DNA strands of different lengths f. Separated (by gel electrophoresis) g. Color of bands tells sequence (read by laser detector, computer software analyzes)

Laser Readout

DNA Manipulation, Cont’d 4. Making Copies (Polymerase Chain Reaction or PCR) a. Small amount of double stranded DNA b. Heated to separate, then cooled c. Add DNA polymerase*, primers (short pieces of artificial DNA), and free nucleotides • *Taq polymerase (from Thermophilus aquaticus) • Isolated from hot springs in Yellowstone • Can withstand hot temperatures d. DNA poly attaches nucleotides to primers e. REPEATED many times (5 minute cycles) f. Use of a thermal cycler

DNA Manipulation, Cont’d 5. Recombinant DNA a. Use RE’s to cut out gene b. Cut host DNA with same RE c. Need a vector to incorporate into host d. Screen for effective transfer e. If successful, then results in Transgenic Organism f. First done by Steven Howell by inserting luciferase gene (for glowing) from firefly into tobacco plant g. Transgenic Organisms 1. Bacteria • Transformation with plasmid • Plasmid: ring of DNA used to transfer genes

2. Plants • Bacterium • Has small DNA plasmid causes tumors • Inactivation of tumor gene • Insertion of foreign DNA • May uptake DNA if cell walls removed • Gene gun! 3. Animals • Viral vectors

4. Nuclear Transfer • Can inject DNA into large egg nuclei • Enzymes used to repair and recombine DNA in cell help insert foreign DNA

5. Scientists may also insert marker gene to tell if procedure worked • ampicillin resistance (bacteria then grown on nutrient medium with ampicillin) • glowing gene from jellyfish (produces GFP) To determine what turns on color in wings, University of Buffalo (NY) biologists inserted a marker gene from jellyfish into African butterflies resulting in fluorescent green eyes

Using Glowing Markers Fruit Fly Embryo Glowing Tobacco!!

6. Knockout Mice • Scientists transfer a defective version of a gene they want to study into stem cells • The defective gene “knocks out” the normal gene, and scientists can examine the effects of the disabled gene on the resulting young mouse. • Using gene targeting, researchers can transfer human disease genes into embryonic stem cells to make mouse models of many human ailments

7. Whole Genome Analysis • Allows analysis of multiple genes in various conditions • “Complexity does not come from the number of genes, but from the way in which they are used” (Gerald Rubin, HHMI VP) • Gene Chips (Affymetrix) • ½ square inch glass with short DNA fragments • ~$200,000 each • Microarrayer • Robot designed by Patrick Brown @ Stanford • Can analyze 6,000 genes in yeast simultaneously • ‘Make your own’ for $25,000

A Microarrayer Shows How Genes in a Yeast Cell Respond to Different Types of Stress http://www.hhmi.org/genesweshare/a110.html

US GOV vs. Celera Genomics

Uses 1. Human Genome Project a. Attempt to map all of human genome! b. Begun in 1999, working draft Feb. 2001, finished 2003 (3 years ahead of schedule!) c. Collaboration of 20 labs in 6 countries d. Competition with Craig Ventnor, Celera Genomics e. Discoveries • 3.2 billion base pairs • only 30-40,000 genes • over 120,000 unique mRNA molecules • only 1-1.5% of human DNA codes for proteins • Each cell has 6 ft of DNA = 1 inch of exons to be transcribed • Most of genome is “Junk DNA” • Genes not evenly distributed • Chromosome 19 packed with genes • Large chromosomes 4 & 8 have few transcribed genes

Types of Genetic Maps

pGLO Plasmid Map

pGLO Sequence ATCGATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGGCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAATGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTGCAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCTAATTCTCATGTTTGACAGCTTATC

2. DNA Fingerprinting a. History • Lynda Mann in England • Raped and Murdered, Nov. 22, 1983 • Local dishwasher questioned & pleads guilty to similar case • Alec Jeffries uses new method of PCR for identification, exonerates dishwasher of both crimes • Every man in area ‘fingerprinted’ by DNA, no matches • Colin Pitchfork finally caught and tested positive (friend went in to fake test for him) • Plant Witness • Murder case in Phoenix, Arizona • Pager found at crime scene led police to suspect (said that victim had robbed him) • Palo Verde pods in truck yielded DNA that matched with trees at crime scene

b. Uses • Identification and exoneration of rapists, criminals • Paternity cases (Jefferson/Sally Hemmings) • Identification of body parts • Supposed heart of Louis XVIII (child king who died in prison) compared to hair from Marie Antoinette • ID of bodies in mass graves in Guatemala (from civil war) • Genetic testing (blood stain on Lincoln’s jacket tested for Marfan’s syndrome) • Migration patterns • ID tags for children, pets • ID of endangered/protected species • Food authentication, such as in wine and caviar • Authentication of official 2000 Summer Olympic goods (sections of DNA taken from several unnamed Australian athletes added to ink used to mark all items)

National Geographic March 2006

c. Use of RFLP’s (restriction fragment length polymorphisms) • Procedure • Restriction enzymes cut DNA differently • Fragments separated with GE • Probed and exposed to X-ray film • Screening for Sickle Cell Anemia • Point mutation of CAG (betaA gene) to CTG (betaS gene) = SNP or single nucleotide polymorphism • Produces valine instead of glutamic acid in hemoglobin molecule • RE’s cut DNA differently • Probe attaches to specific sequence • Affected = large fragment • Pedigree shows family; son with sickle-cell anemia • Electrophoresis pattern below each child

d. DNA Typing • Small percentage of DNA different from person to person (less than 1/10th of 1%) • Variable regions used for comparison Gel Lanes MARKERS VICTIM EVIDENCE #1 (semen stain left on the victim's clothing) EVIDENCE #2 (semen from the vagina of the rape victim) SUSPECT #1 SUSPECT #2 CONTROL (check to see if probes are working) • Results • Suspect #2 can be clearly ruled out • Suspect #1 MAY be guilty (probability that 6 alleles match is 1 in 4056) • Suspects NOT picked at random: Evidence used in conjunction with • More probes (alleles) the better: 14 = chance of match is 1 in 268 million

• More by User

Biotechnology. The use of living cells to make products such as pharmaceuticals, foods , and beverages The use of organisms such as bacteria to protect the environment The use of DNA science for the production of products, diagnostics, and research. Hollywood likes genetics.

1.58k views • 41 slides

Biotechnology. Reading quiz. Identify the term that best represents each description 1. When a bacteria is not affected by chemicals that interfere with its life processes 2. A rod shaped bacterial cell 3. Chemicals that interfere with bacteria’s life processes

1.07k views • 53 slides

BIOTECHNOLOGY

BIOTECHNOLOGY. BIOTECHNOLOGY TERMS. Gel electrophoresis Cloning DNA fingerprint Stem cells Transgenic Human Genome Gene therapy Project Restriction enzymes Bacterial transformation Bioethics. DNA Fingerprinting (Profiling). DNA Fingerprint. DNA is extracted from cells

1.27k views • 69 slides

Biotechnology. Techniques used to manipulate DNA. Biotechnology . Many applications:. Medical. Bacterial production of human insulin. Animal science. Bacterial production of BST to increase milk production. Horticultural. Transgenic crops with herbicide resistance or nutrient enhancement.

471 views • 13 slides

Biotechnology. Prosthetics. “Imagine an artificial arm that moves naturally in response to your thoughts, that allows you to feel both the outside world and your own movements, and that is as strong and graceful as an intact, biological limb.”. What are prostheses?.

426 views • 18 slides

What is Biotechnology?. bio' the use of biological processestechnology' to solve problems or make useful products. Modern' biotechnology the use of cellular and molecular processes to solve problems or make useful products. Emerging Areas in Biotechnology. BiosensorsGenomics/Bioinformati

366 views • 12 slides

Biotechnology. What is biotechnology?. Bio —the use of biological (life) processes Technology —solve problems or make useful products. 10. What does biotechnology produce?. Foods Vaccines Antibiotics Vitamins Biodegradation Selective breeding. 9. How does biotechnology work?.

790 views • 12 slides

Biotechnology. What is it?. I. Biotechnology . A branch of science that uses living organisms to manufacture food, medicines, or other products to improve our lives. . II. History of Biotechnology.

631 views • 24 slides

BIOTECHNOLOGY. AP BIOLOGY 12 GORSIC. Biotechnology. Biotechnology : manipulation of organisms or their components to perform practical tasks or provide useful products Genetic engineering: direct manipulation of genes for practical purposes. Practical DNA Technology Uses.

433 views • 23 slides

Biotechnology. Biotechnology. The use of microorganisms, or biological substances, such as enzymes, to perform specific industrial or manufacturing processes. Science Fact or Fiction?. http://www.flickclip.com/flicks/jurassicpark3.html. Genetic Engineering. The process of producing

745 views • 57 slides

Biotechnology . Review Gam. Biotechnology. A change in the chromosome structure caused by radiation, chemicals, pollutants, or during replication is a/an? Allele Gene Replicator Mutation . Biotechnology.

751 views • 56 slides

BIOTECHNOLOGY. Kavery Kandasamy. D. MOLECULAR GENETICS (12 U) D1. analyze some of the social, ethical, and legal issues associated with genetic research and biotechnology

652 views • 46 slides

Biotechnology :

Biotechnology :. What Ethical Issues are Raised by the Use of Biotechnology?????. John &amp; Elsa Case Study:. Run a Family Farm Possibility of Going out of Business Need to Decide Whether or Not to Use Bovine Growth Hormone . Concerned about if customers would still buy milk with BGH.

445 views • 18 slides

Biotechnology:

Biotechnology:. How Do We Use What We Know about Life?. Role of bacteria in technology. Advantage to using bacteria Possess plasmids Small extra loops of DNA Experience transformation Bacteria take up plasmids from surroundings. Role of bacteria in technology.

572 views • 42 slides

Biotechnology. sub - topic B problems with profit and waste. Part 1 SEWAGE. The effect of untreated sewage on rivers. Rivers contain bacteria . These bacteria use oxygen during aerobic respiration. Untreated raw sewage contains organic material ( faeces ,food fragments, soap etc).

679 views • 49 slides

Biotechnology. Biotechnology is the use of biological processes, organisms, or systems to manufacture products intended to improve the quality of human life. Genetic Engineering - (A.K.A. Recombinant DNA Technology).  frequency of an allele in a population

792 views • 39 slides

Biotechnology. Plant and Soil Science Plant Science Technology Lesson 1 &amp; 2. What Is Biotechnology?. Any technique that uses living organisms or substances from those organisms to make or modify a product, to improve plants or animals, or to develop microorganisms for specific uses.

307 views • 12 slides

Biotechnology. Biotechnology : The use of microorganisms, cells or cell components to make a product. Genetic Engineering : inserting genes into cells for biotechnological purposes. Introduction. Today’s lecture will focus on Fig. 10.9 on page 297.

311 views • 18 slides

Biotechnology. 4 major areas Human Genome Project Gene Therapy Forensic science Agriculture. Human Genome Project. Aim Identify sequence of bases on all 23 human chromosomes (3 billion bases) Identify genes within those sequences (~30 000 genes)

584 views • 42 slides

Biotechnology. Why Biotech?. Used widely in industry today Many possible applications Used extensively in the food industry – value-added products Genomics is just beginning. My knowledge is limited… where do I start?. Two Types of Biotech. Old vs New. History of Biotechnology.

425 views • 22 slides

Biotechnology. Selective Breeding. Nonrandom mating to select for characteristics in parents that are desired in the offspring. Eg. Breeding domestic animals, domestic crops- corn. Genetic Engineering. Direct manipulation of genes to alter hereditary traits.

550 views • 22 slides

Biotechnology. By Larry Stine Estherville Lincoln Central High School. Modified by Georgia Agricultural Education Curriculum Office June 2002. Competencies:. define biotechnology, DNA, and other related terms compare methods of plant and animal improvement

417 views • 24 slides

Fungal biotechnology - PowerPoint Presentation

Fungal biotechnology - ppt presentation.

Introduction of Fungal Biotechnology Biotechnology which can simply be defined as the application of living organisms and their components to industrial products and processes Biotechnology ID: 1031848

enzymes fungi fungal important fungi enzymes important fungal processes food commercially chemical species yeast industrial biotechnology years fermentations range

Download Presentation The PPT/PDF document "Fungal biotechnology" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

1. Fungal biotechnology

2. Introduction of Fungal BiotechnologyBiotechnology which can simply be defined as “the application of living organisms and their components to industrial products and processes Biotechnology also offers the potential for new industrial processes that require less energy and are based on renewable raw materials.not just concerned with biologyinterdisciplinary subject (integration of natural and engineering sciences).

3. Uses of Fungiproduction of enzymesVitamins polysaccharidespolyhydric alcohols pigmentsglycolipids.Some of these products are produces commercially while others are potentially valuable in biotechnology.

4. Fungal secondary metabolites extremely important to our health and nutrition and have tremendous economic impacts.In addition to the multiple reaction sequences of fermentations, fungi are extremely useful in carrying out biotransformation processesRecombinant DNA technology which includes yeast and other fungi as hosts has markedly increased markets for microbial enzymes.

5. Molecular manipulations in the discovery of new drugs.Today fungal biotechnology is a major participant in global industry. Moreover, the best is yet to come as genomes of additional species are sequenced at some level and gene and protein arrays become available.

6. Food applicationsBrewing and baking (thousands of years) both are dependant on the conversion of sugar into alcohol and carbon dioxide by yeast.Early processes were dependant on contamination by wild yeast. Today pure strains are normally employed and some 1.5 million tons of bakers yeast (Saccharomyces cerevisiae).Aspergillus oryzae, is now used to produce a range of commercially important enzymes.

7. Oriental food fermentations such as the one used to produce soy sauce were originally carried out as home or cottage industries.Traditional fermentations could take several months but this has been reduced to 2-3 days in a modern plantCultivation of edible mushrooms outdoors has been practiced for hundreds if not thousands of years.

8. However, even today only a handful of species are grown commercially on large scale although these represent a multi billion dollar industry. Many of the most sought after species e.g. Boletus edulis, Cantharellus cibarius Hydnum repandumTricholoma matsutake Tuber melanosporum) are believed to be dependent on mycorrhizal associations.

9. A recent innovation in food technology has been the development of Quorn mycoprotein from a filamentous fungus (Fusarium graminearum)The culture was isolated from a field in Marlow, Buckinghamshire.The filamentous nature of the biomass is responsible for the meat-like texture and appearance of final product.

10. Useful productsMany important industrial products are now produces from fungi using fermentation technology.Citric acid which is widely used in food and pharmaceutical companies.A wide range of enzymes are extracted by fungi and play an important role in the breakdown of organic materials; many of these enzymes are produced commercially.

11. Cellulase enzymes could replace the pumice stones used by industry to produce 'stone-washed' denim garments. Another novel textile application for cellulase enzymes is in biopolishing, the removal of fuzz from the surface of cellulosic fibers which eliminates pilling making the fabrics smoother and cleaner-looking.

12. Fungi are well known source of antibiotics but new therapeutic compounds with novel pharmacological activities have also been developed in recent years (e.g. Tolypocladium inflatum). Cyclosporin A is currently the most widely used drug for preventing rejection of human organ transplants .The polysacchrides chitin and its derivatives chitosan have a wide range of industrial applications. Filamentous fungi grown under controlled conditions are an attractive source of chitin and chitosan where a high quality product is required.

13. Other processesFungi can be used in new production processes that are t less polluting than traditional chemical processes white rot fungi degrade toxic waste.Many fungi produced pigments during their growth which are substantive as indicated by the permanent staining that is often associated with mildew growth on textiles and plastics.

14. Lignin-degrading fungi or their enzymes also have the ability to degrade highly toxic organic compoundsdioxins polychlorinated biphenyls an important role in the remediation of contaminated soils and the disposal of chemical waste. The use of fungi as biocontrol agent Mycoinsectisides (Metarhizium anispoliae) first mycounsecticide Mycoherbicides

15. Recent studies have suggested that lignin-degrading or white-rot fungi (note: decay caused by these species gives wood a bleached appearance) such as Phanerochaete chrysosporium and Trametes versicolor could replace some of the chemical steps used in paper making.Some fungal pigments have been shown to be anthraquinone derivatives, resembling the important group of vat dyes. Fungi therefore have potential as agents for the direct production of textile dyes or dye intermediates replacing chemical synthesis which has inherent waste disposal problems.

Related Contents